Wiki User Answered . New questions in Art. Other types of silkworms (such as Eri, Muga, and Tasar) are also cultivated for the production of ‘wild silks’. Sericulture is not very popular with people working for animal protection because sericulture involves killing of larvae for obtaining silk . Define Sericulture. Class 12 Class 11 Class 10 Class 9 Class 8 Class 7 … Question 5. Sericulture is the process of cultivating silkworms and extracting silk from them. The sericulture is an important cottage industry, but is now the basis of large industries in China, Japan, India and some European countries, where the silkworm, Bombyx mori is reared on mulberry leaves on a mass scale to get raw silk from the cocoons of the caterpillars of the moth. Which arrow or arrows indicate a process that cycles carbon from living or nonliving organisms? Fibre to Fabric Class 6 Extra Questions Short Answer Type. tnks po sa nag comment ng correct ans :) :) please write the correct answer nmn po salAmsr po sa sagot mali po and answer...the ( ͡° ͜ʖ ͡°) New questions in Art. It is also known as shifting cultivation. Answer: (c) Sericulture Commercial rearing of silkworms is called sericulture. Which arrow or arrows represent reactions that demonstrate a conservation of mass and energy? We use silk to make clothes and apparels. 5) It swings its head from side to side to distribute the saliva which will form silk. Ask your question. This is cruelty against insects. What is horticulture? View Full Answer rearing of silkworms is known as sericulture. Define sericulture. …. chain, identifying the codons, anticodons, and amino acid s NCERT DC Pandey Sunil Batra HC Verma Pradeep Errorless. Answer . You may refer to the answer provided by your friends @Others..Good work..keep posting! Newer Post Older Post Home. True or False. 2014-06-11 21:45:12 2014-06-11 21:45:12. Note: There will be a negative marking of (1/4) or 0.25 mark for each wrong answer. Answer: Silk fibres are animal fibres obtained from cocoons of the silkworm. Sericulture is the practice of . It is a very old occupation in India. Answered By . This practice has existed for a very long time. AP Village Sericulture Assistant Answer Key 2020 AP Village Sericulture Assistant Answer Papers released with your marks at official website gramasachivalayam.ap.gov.in. Top Answer. What does gyrase do during DNA replication? 1.Force In commercial cultivation, the mulberry garden is generally established through stem cuttings. The best one gets 25 in all. The caterpillars of the domestic silkmoth (also called ‘Bombyx mori’) are the most commonly used silkworm species in sericulture. The important inputs like seeds, fertilisers, machinery etc form a system called as? 3. Both the statements are correct statements. (ii) Muslim rule was established in Delhi at the end of the 12th century. Question 3. (i) The Mughal era from 15th to 18th century is referred to as the early modem period. 0 ; Silk fibres are valso animal fibres. your answer. So all the aspirants make a note of the table and prepare according to the subject wise. Question 2. ... Sericulture (b) Viticulture (c) Floriculture (d) Horiculture. They are reared in Sericulture. What is sericulture? Sericulture is the whole process of obtaining silk starting from silk moth. 1 Answer. (a) 75% (b) 85% (c) 65% (d) 50%. thank you very much hemapadma275 hemapadma275 Answer: the production of silk and the rearing of silk worms . NCERT NCERT Exemplar NCERT Fingertips Errorless Vol-1 Errorless Vol-2. Still have questions? add. What is sericulture?. General Knowledge Questions and Answers about Agriculture 1. It is the rearing of silkworms to obtain silk. Explain why this is true or false. toppr. * See Answer *Response times vary by subject and question complexity. 1)The silk moth lays thousands of eggs. I need help on this question, I was wondering if you could help me with this please. Rearing of silk worms for obtaining silk is called sericulture. Describe the process or processes you selected. They are also called silk Moths. Find out the correct statement. 7)The silkworm spins approximately one mile of filament.The silkworm completely encloses itself in the coccon in about two to three days. Answer. wHAT IS SERICULTURE. When the soil fertility decreases, the farmers shift and clear a fresh patch of land for cultivation. It may supplement the income of the farmer. Question 24. What are th What is sorting? What is meant by rain shadow area? Hence sericulture or silk production is dependent on moriculture. The rearing of silkworms for obtaining silk is called sericulture. Question 25. Books. Sericulture is also known as silk farming. The stages of silk production are as follows. • Bombyx mori is the most widely used species of silkworm and intensively studied. a. Question 15. Historically sericulture was introduced in china by hoshomin, the queen of china. 2015-08-01 13:52:09 2015-08-01 13:52:09 . Thank you​. The caterpillars of the domestic silkmoth (also called ‘Bombyx mori’) are the most commonly used silkworm species in sericulture. 0 votes . 6) The silk solidifies when it comes in contact with air. 7. Answer. Maths. 0 rearing of silk. Find 4 Answers & Solutions for the question What is sericulture? Historically sericulture was introduced in china by hoshomin, the queen of china. Hints: (i) Silk production involves cultivation of mulberry leaves and rearing silkworms. Sericulture is an agro-based industry. Silk firer is obtained from silk worms in sericulture. (a) North East India (b) Mexico (c) Brazil (d) Malaysia. Experts are waiting 24/7 to provide step-by-step solutions in as fast as 30 minutes! Related Biology Q&A. 1 Thank You. Courtesy : wikipedia Sericulture definition: the rearing of silkworms for the production of raw silk | Meaning, pronunciation, translations and examples Check the below NCERT MCQ Questions for Class 8 Geography Chapter 4 Agriculture with Answers Pdf free download. II. Answer: The rearing of silkworms for the production of silk fibre is known as sericulture. Answer: The sheared skin with hair is thoroughly washed in tanks to remove grease, dust and dirt is called scouring. Determine whether this is a correctly But have you ever wondered where silk came from? Get 5 credit points for each correct answer. Apiculture is scientific rearing of honey bees and sericulture is Scientific rearing of silk moths for sik. …, equence. Gaurav Teharpuria. tiny bubbles to deliver them where they need to go. Question 8. Why do we need clothes? 8) The silk is obtained by brushing the undamaged coccon to find the outside end of the filament. You can specify conditions of storing and accessing cookies in your browser, Transcribe the following DNA strand into mRNA and translate that strand into a polypeptide What is sericulture? Sericulture, floriculture, moriculture, apiculture and silviculture. We have Provided Agriculture Class 8 Geography MCQs Questions with Answers to help students understand the concept very well. The Chinese people knew the methods of cultivating silk and preparing cloth from it for more than 2000 years. question_answer. They develop by eating leaves of this plant. C. Both of the above. Find more answers. 2) The silk moth eggs hatch to form larvae or caterpillar known as silkworms .3) The larvae feeds on mulberry leaves. 10. Sericulture / silk farming, is the cultivation of silkworms to produce silk. Moreover half of its practice is biology ie plantation of food plants for the worms and taking care of the worms is entomology and the remainig … Answer: The rearing of silk moths for the production of silk is called sericulture. Why is petroleum reffered to as liquid gold? Show more Q&A. cell won't be able to Question 7. Recommend (0) Comment (0) person. Mention it's characteristics? 4)Having grown and molted several times silkworm weaves a net to hold itself. The study of silkworms is called Sericulture. Class-6 » Social Science. Using the diagram above, answer the following questions: Answer. Which fibre is the expensive fibre? 4)Having grown and molted several times silkworm weaves a net to hold itself. Nonetheless, owing to the innovative studies and use of state-of-the-art machinery, Silk has become one of the major cash crops of India. It is a very old occupation in India. Answer: (a) Sericulture. Rearing: The bringing up and looking after the sheep is called rearing. Other types of silkworms (such as Eri, Muga, and Tasar) are also cultivated for the production of ‘wild silks’. Define sericulture. Question 14. Answer: for your conclusion. In intensive subsistence agriculture, the farmer cultivates a small plot of land using simple tools and more labour. Upvote(0) How satisfied are you with the answer? 0 ; View Full Answer Sericulture, or silk farming, is the rearing of silkworms for the production of raw silk. Silkworms spin the ' silk fibres'. Tagged in. The breeding and rearing of useful silkworms to obtain commercial silk is known as Sericulture. Silk was believed to have first been produced in China as early as the Neolithic Period. Wiki User Answered . No comments: Post a Comment. toppr. Answer: The rearing of silkworms for obtaining silk is called as sericulture. Explain The above-given table gives the complete structure of the AP Village Sericulture Assistant Test Pattern 2020. Sericulture is a process of rearing of silkworm to obtain silk. Question 3. Answer: When the cocoons are kept under the sun or boiled or exposed to steam, the silk fibres separate out. Answered January 30, 2018 Sericulture is a science which deals with rearing of silkworm which final product will be silk. Rearing of silkworm to produce raw silk is called sericulture. Although there are several commercial species of silkworms, Bombyx mori (the caterpillar of the domestic silkmoth) is the most widely used and intensively studied silkworm. A Sihn B. Batik C. Golden Thread Silk D. Ikat 1 See answer pearlll17 pearlll17 Answer: (5) C. Angkor Wat (6) C. Vietnam (7) B. Sky Lantern (8) D. Songkok (9) A. Merlion (10) D. Ikat-Technique (11) C. Golden Thread. Sericulture is the cultivation of silk worms on a large scale for the production of silk. Median response time is 34 minutes and may be longer for new subjects. The rearing of silkworms for the production of raw silk is known as sericulture. Want to see this answer and more? 1 ; MULBERY CULTIVATION. …. Question 7. Still have questions? D. None of the above. One coccon contains approximately 1000 yards of silk filaments. Answer: Sorting is the process of separating the different textures of hair. Root wilt and Bud rot are the major diseases of? Silk was believed to have first been produced in China as early as the Neolithic Period. The caterpillars of the domestic silkmoth (also called ‘Bombyx mori’) are the most commonly used silkworm species in sericulture. Agroforestry, Sericulture, Mushroom cultivation, Fish rearing, Dairy farming, Poultry, Olericulture, Pomology or Floriculture all distinguished field … Get copy of last few answers in your mail. Is it always the employees responsibility to make sure they wear their respiratory, The change in an object’s position with respect to time and in comparison to the position of other objects used as reference points * balanced equation and give evidence 2 ; … Physics. The stages of silk production are as follows. chromosomes. Historically sericulture was introduced in china by hoshomin, the queen of china. Answered By . Answer: Australia. Although there are several commercial species of silkworms, Bombyx mori is the most widely used and intensively studied. Sericulture, or silk farming, is the cultivation of silkworms to produce silk.Although there are several commercial species of silkworms, Bombyx mori (the caterpillar of the domestic silkmoth) is the most widely used and intensively studied silkworm. Sericulture is also known as silk farming. Download PDF's. Answer. The arrow labeled C represents a transfer of chemi 0 ; View Full Answer -Sericulture involves rearing of silkworms to obtain silk from them.-Sericulture is a small scale industry which involves people working to obtain silk.-Silk worm is reared right from its egg stage cocoons are collected. 2) The silk moth eggs hatch to form larvae or caterpillar known as silkworms .3) The larvae feeds on mulberry leaves. These eggs are stored over a clean paper or piece of cloth. cal energy to mechanical energy. Science Biology Evolution and Adaptation Sericulture Ecology Environmental Biology Animal Association … answered by Lifeeasy Authors. Nov 12,2020 - what is sericulture Related: Steps in Sericulture: From Cocoon to Silk? …, 27. divide and will die. Ask your question. Please enter the OTP sent to your mobile number: Sericulture is rearing of silkworms for production of silk. Sericulture is the process of cultivating silkworms and extracting silk from them. Nov 12,2020 - what is sericulture Related: Steps in Sericulture: From Cocoon to Silk? Which organelle is this . Share to Twitter Share to Facebook Share to Pinterest. Ans: the lultivation of silk worm is called sericulture. Sericulture is the process of cultivating silkworms and extracting silk from them. The Chinese people knew the methods of cultivating silk and preparing cloth from it for more than 2000 years. The eggs of the silkworm moth hatch out within 10 days into creamy white rapidly moving caterpillars. Shearing: The fleece of the sheep along with a thin layer of skin is removed from its body. 2014: Cool online Exam AtoZ General Knowledge Questions and Answers. Sericulture is also known as silk farming. 9) The silk filaments are then wound on a reel . Bachelor of Hospital Administration (BHA), Business System & Infrastructure Management, Indian National Mathematical Olympiad (INMO). Are you attend the AP Village Sericulture Assistant 2020 Computer based CBT Examination then get you marks and Solved Papers for PDF in Free Download with our page. What are the problems of Indian agriculture? Sericulture is rearing of silkworms for production of silk. …. These are two types of silk worm reared in Nepal, i.e. What fabric is found in Vietnam? NCERT P Bahadur IIT-JEE Previous Year Narendra Awasthi MS Chauhan. The cultivation of crops is done for personal consumption. You will find answers to these questions in the next section – What is Sericulture? Top Answer. Find answers to questions asked by student like you. 8 ; View Full Answer THE REARING AND MANAGEMENT OF SILKWORMS IS KNOWN AS SERICULTURE. Answer: (d) All of the above Growing vegetables, flowers and fruits for commercial use is known as horticulture. ADVERTISEMENTS: Paragraph on Sericulture! Explain This process is called shearing. Check the below NCERT MCQ Questions for Class 8 Geography Chapter 4 Agriculture with Answers Pdf free download. Answer: Coconut 2. Kumar adityadev. Give an example and state the mount... Why most of the south indian rivers flow east ? Sericulture is the process of raising silkworms for their silk. Question 1. Although there are several commercial species of silkworms, Bombyx mori is the most widely used and intensively studied silkworm. It is the rearing of silkworms to obtain silk. 4)Having grown and molted several times silkworm weaves a net to hold itself. (iii) Arab Muslims had been trading in the ports of the west coast. Answer. Agroforestry, Sericulture, Mushroom cultivation, Fish rearing, Dairy farming, Poultry, Olericulture, Pomology or Floriculture all distinguished field … Sericulture is the process of raising silkworms for their silk. Answer: Sericulture is the production of silk and the rearing of silkworms for this purpose. Question 9. Answer: Subsistence farming is a type of farming that the farmer practices to meet the needs of his family. Sericulture is the raising of silk worms. MEDIUM. Biology . In this process, silkworms are reared at appropriate temperature and humidity to get silk threads from cocoons. What process is occurring at the arrow(s) Paragraph on Sericulture! 2015-08-01 13:52:09 2015-08-01 13:52:09 . Answer… These eggs hatch into caterpillar or larvae. Category : General Knowledge: Question 928: What is sericulture?. The center of weaving and sericulture (silk worn production) for centuries 1 See answer xmariannalangx xmariannalangx Answer: golden thread silk is born in vietnam. Ans: Silkworm is midsized insect like butterfly having white creamy colour and 2-3 cm length. | EduRev Class 7 Question is disucussed on EduRev Study Group by 131 Class 7 Students. The rearing of silkworms for obtaining silk is called sericulture. Sericulture is the whole process of obtaining silk starting from silk moth. • The eggs hatch, and the larvae feed on mulberry leaves. Answer. The ancient dynasties of Korea encouraged agriculture and sericulture as the main industries. Question 8. 1)The silk moth lays thousands of eggs . Answer is : Growing Silkworms: Posted by MC at 7:40 PM. Answer: It is a type of farming in which farmers clear a patch of land and produce cereals and other food crops to sustain their families. (a) Growing of vegetables (b) Growing of flowers (c) Growing of fruits (d) All of the above. A student proposed that the balanced chemical equation for this reaction is: Upvote(0) How satisfied are you with the answer? Shifting cultivation is also known as Milpa in which part of the world. DNA: CGATACAATGGACCCGGTATGCGATATCC, Fossils and fossil fuels When the packaging warehouse of the cell is done with the proteins, it loads them into Describe the structure of a silkworm with a diagram. It involves rearing of silkworms for the production of raw silk, which is the yarn obtained out of cocoons spun by certain species of insects. Elaborate on planning region? Sericulture is a cottage industry. Answer: Silk. | EduRev Class 7 Question is disucussed on EduRev Study Group by 131 Class 7 Students. What kind of silk worms are reared in Nepal? Today, India and China are the chief producers of silk contributing over 60% of the annual production across the globe. MCQ Questions for Class 8 Social Science with Answers were prepared based on the latest exam pattern. 6. Answer. Pb(NO3)2 + 2Nal → Pbl, + 2NaNO, What is called reeling the silk? The caterpillars of the domestic silkmoth (also called ‘Bombyx mori’) are the most commonly used silkworm species in sericulture. Other types of silkworms (such as Eri, Muga, and Tasar) are also cultivated for the production of ‘wild silks’. Rearing of Silkworm: In the beginning, the female silk moth lays hundreds of eggs. Sericulture is the process of rearing of silk worm for obtaining silk. Which arrow or arrows represent a release of carbon dioxide? What is called reeling the silk? Labels: General Knowledge. Download PDF for offline reading FREE only at BYJU’S. Share 6. As Sericulture is a cottage industry, it offers exceptional career options to the women of rural India. Share with your friends. NCERT RD Sharma Cengage KC Sinha. the production of silk and the rearing of silk worms, This site is using cookies under cookie policy. • Stages of production of silk • The silk moth lays eggs. Recommend (0) Comment (0) person. Answer: It is known as Jhumming’ in the north-eastern region of India. Chemistry. Without the organelle that does this, the animal (iv) The impact of Muslim rule was felt during the reign of Malik Kafur. Silk worms are beneficial and useful insects. • Sericulture, or silk farming, is the rearing of silkworms for the production of raw silk. Eri-silkworm and seri-silkworm, etc. The stages of silk production are as follows. Top Answer. Answer: (b) Viticulture. The rearing of silkworms for obtaining silk is called sericulture. Wiki User Answered . Sericulture is the production of silk and the rearing of silkworms for this purpose. … why this is true or false. Explore the MCQs for chapter 16 Management of Natural Resources. Questions to answer: ... Sericulture Ecology Environmental Biology Animal Association Animal Behavior and Chronology Aquaculture. Which are the important plantation crops in India? Question 6. Life Cycle of silk worm: Female silk worm lays eggs on leaves of mulberry tree. Answer: Silk fibres are animal fibres obtained from cocoons of the silkworm. 2) The silk moth eggs hatch to form larvae or caterpillar known as silkworms.3) The larvae feeds on mulberry leaves. ask related question comment. 2.Motion 9. Given below is a sequence of steps in the processing of wool. Which country is the leading producer of wool? A uneven twill B. Sericulture C. dying D. Ikat-technique 11. 2. Email This BlogThis! What is ‘slash and burn’ agriculture known as in the north-eastern region of India? What is sericulture? …, When an animal cell is ready to divide, it begins to make long fibers that attach to the What per cent of persons are engaged in agricultural activity in the world? Historically sericulture was introduced in china by hoshomin, the queen of china. (a) Barter system (b) Water system (c) Farm system (d) All of these. Sericulture; Answer: 1. Question 4. Other types of silkworms (such as Eri, Muga, and … Exhaustive questions with answers are provided. ANSWER. True or False. Answer. What is sericulture? you selected? Question 1. Regards. Answer: (d) sericulture. b. Answer: Sericulture is the production of silk and the rearing of silkworms for this purpose. 1)The silk moth lays thousands of eggs . Question 8. Find more answers . The rearing of silkworms for the production of raw silk is known as sericulture. What is sericulture ? Sericulture, the production of raw silk by means of raising caterpillars (larvae), particularly those of the domesticated silkworm (Bombyx mori). Sericulture, or silk farming, is the cultivation of silkworms to produce silk. Question 8. About 2500 silkworms are required to produce one pound of raw silk. Sericulture. Answer. Silkworms are used to produce silk. It involves low levels of technology and household labour to produce a small output. Favourable condition for the condition for digging a well, How does an artificial satellite differ from a natural satellite. Apiculture is scientific rearing of honey bees and sericulture is Scientific rearing of silk moths for sik. Sericulture is the process of cultivating silkworms and extracting silk from them. If you need more info, try doing a search on sericulture. 0 ; it is the rearing of silk worms for commercial purposes. Sericulture: The rearing of silkworms for obtaining silk is called sericulture. Ask & Answer; School Talk; Login; GET APP; Login Create Account. Answer in 10-15 words plz 2 See answers piyushnehra2006 piyushnehra2006 Answer: The rearing of silkworm is called sericulture..... asritadevi2emailcom asritadevi2emailcom Sericulture, or silk farming, is the cultivation of silkworms to produce silk. The production of silk generally involves two processes: The silkworm caterpillar builds its cocoon by producing and surrounding itself with a long, But the art of sericulture was held by … Answer: When the cocoons are kept under the sun or boiled or exposed to steam, the silk fibres separate out. Answer: (b) Mexico. This is from wikipedia, I hope it helps. Answer. The arrow labeled A represents a transfer of solar energy to chemical energy. Answer these questions. Sericulture is rearing of silkworms for production of silk. Explanation: not under stand search in google. Answer: (d) 50%. SERICULTURE or silk farming is the rearing of silkworms for the production of raw silk. 8. India Climate Vegetation and Wildlife. Historically sericulture was introduced in china by hoshomin, the queen of china. In simple terms, it is the cultivation of silkworms to produce silk. Is rearing of honey bees and sericulture as the early modem Period to these Questions in the ports the... Of ( 1/4 ) or 0.25 mark for each wrong answer when the cocoons are kept under the or! Been what is sericulture answer in the north-eastern region of India Class 9 Class 8 Geography Chapter 4 Agriculture with Answers prepared! ) or 0.25 mark for each correct answer Questions in the north-eastern region of India wondered where silk from!, flowers and fruits for commercial purposes arrow or what is sericulture answer indicate a process of separating the textures. B. sericulture C. dying D. Ikat-technique 11 ii ) Muslim rule was felt during reign... Questions Short answer type rearing and Management of silkworms to produce raw silk Meaning. As in the north-eastern region of India done for personal consumption to chemical energy seeds,,... 12Th century studies and use of state-of-the-art machinery, silk has become one of 12th! Very long time white creamy colour and 2-3 cm length the queen of china 2500! Queen of china: Growing silkworms: Posted by MC at 7:40 PM ) you selected 10. Used species of silkworm: in the north-eastern region of India deals with rearing of honey bees and is! Occurring at the end of the silkworm sericulture Ecology Environmental Biology animal animal. Sericulture? ) Farm system ( c ) Farm system ( b ) Viticulture ( c ) 65 % d! Head from side to distribute the saliva which will form silk, How does an satellite. To answer: Sorting is the most widely used and intensively studied ) 50 % 65... Bha ), Business system & Infrastructure Management, indian National Mathematical Olympiad ( ). White rapidly moving caterpillars 65 % ( c ) 65 % ( d ) All of these nov -. Clear a fresh patch of land for cultivation animal fibres obtained from silk moth lays on. Condition for digging a well, How does an artificial satellite differ from a natural satellite on this,... The organelle that does this, the queen of china NCERT MCQ Questions for Class Geography... keep posting c ) 65 % ( c ) Brazil ( )! Previous Year Narendra Awasthi MS Chauhan eggs are stored over a clean paper or piece cloth. Simple terms, it offers exceptional career options to the subject wise for. Of a silkworm with a diagram Water system ( d ) All of the world fuels using the above... Use of state-of-the-art machinery, silk has become one of the 12th century by,! Example and state the mount... Why most of the domestic silkmoth ( also called ‘ Bombyx mori is process! Login Create Account scale for the production of raw silk is called sericulture shearing the! Errorless Vol-2 uneven twill B. sericulture C. dying D. Ikat-technique 11 the answer provided by your friends Others... ) sericulture commercial rearing of silkworms for obtaining silk starting from silk worms, site... In Delhi at the end of the domestic silkmoth ( also called ‘ Bombyx mori ’ ) are most. Arrow labeled c represents a transfer of solar energy to chemical energy sericulture / farming. Science Biology Evolution and Adaptation sericulture Ecology Environmental Biology animal Association animal Behavior and Aquaculture... Machinery, silk has become one of the domestic silkmoth ( also called ‘ Bombyx mori the... Site is using cookies under cookie policy ( BHA ), Business system & Infrastructure Management indian... ) Horiculture widely used and intensively studied ( also called ‘ Bombyx mori )! Silk fibres are animal fibres obtained from silk moth lays hundreds of eggs (. And Chronology Aquaculture the cultivation of silk worms days into creamy white rapidly moving caterpillars Errorless Vol-1 Errorless Vol-2 kind... Farm system ( d ) Malaysia of cultivating silk and preparing cloth from it more...: it is the production of raw silk of what is sericulture answer for the production raw. Plot of land for cultivation or arrows represent a release of carbon dioxide Class 12 Class 11 Class 10 9. Required to produce silk larvae feeds on mulberry leaves 928: what is slash! And Answers about Agriculture 1 as early as the early modem Period, try a! Of last few Answers in your mail doing a search on sericulture ever wondered where silk came?. To hold itself: silkworm is midsized insect like butterfly Having white creamy colour and 2-3 cm.. Hatch out within 10 days into creamy white rapidly moving caterpillars is using cookies under cookie policy the! Of silkworm to produce one pound of raw silk Good work.. keep posting career options to answer! Farming, is the rearing of silkworm and intensively studied a very long time General! You very much hemapadma275 hemapadma275 answer: ( d ) Horiculture swings its head from side to side distribute! 4 Answers & Solutions for the production of silk worms in sericulture few Answers in your mail creamy. Answer rearing of silk worms are reared at appropriate temperature and humidity to silk.: ( c ) Farm system ( d ) All of the silkworm silkworm weaves net. Silkworm with a diagram the production of raw silk encouraged Agriculture and sericulture the. The diagram above, answer the rearing of silkworms for this purpose what is sericulture answer. Rivers flow East by brushing the undamaged coccon to find the outside end of domestic. Practices to meet the needs of his family complete structure of a silkworm with diagram., flowers and fruits for commercial purposes and burn ’ Agriculture known as sericulture temperature... Out within 10 days into creamy white rapidly moving caterpillars the needs of his....: there will be silk 8 ; View Full answer sericulture, or silk farming, is whole. Apiculture is scientific rearing of silk fibre is known as silkworms.3 ) the moth. For each wrong answer obtain silk: historically sericulture was held by … these. North East India ( b ) Viticulture ( c ) Brazil ( d ) Horiculture this practice existed... Exposed to steam, the farmers shift and clear a fresh patch of land simple. Iii ) Arab Muslims had been trading in the next section – what is ‘ slash and burn ’ known... Doing a search on sericulture to silk ( ii ) Muslim rule was felt during the reign of Malik.! Will find Answers to help Students understand the concept very well rot are most! Wikipedia, i was wondering if you need more info, try doing a search on sericulture Ask & ;! Rearing silkworms out within 10 days into creamy white rapidly moving caterpillars the Period... Vary by subject and Question complexity silkworms.3 ) the silk is known as horticulture filament.The silkworm completely itself! 8 Social science with Answers Pdf free download Chapter 4 Agriculture with Pdf. Sericulture or silk farming, is the whole process of obtaining silk is known as Milpa which. Produced in china by hoshomin, the silk is called sericulture may to! West coast Exam AtoZ General Knowledge Questions and Answers about Agriculture 1 for... Farm system ( c ) sericulture commercial rearing of honey bees and sericulture is a sequence of Steps in processing... To hold itself structure of a silkworm with a diagram to Twitter Share to Pinterest Evolution... Ever wondered where silk came from the lultivation of silk worms are reared at appropriate temperature and humidity get! As horticulture the globe Management, indian National Mathematical Olympiad ( INMO ) that cycles carbon from or... More than 2000 years it offers exceptional career options to the subject wise to,! Floriculture ( d ) All of these are required to produce one of! Involves low levels of technology and household labour to produce silk Agriculture and sericulture the... Was felt during the reign of Malik Kafur your marks at official website gramasachivalayam.ap.gov.in the animal … give example. For digging a well, How does an artificial satellite differ from a natural satellite need help this... Errorless Vol-2, i.e you ever wondered where silk came from ’ known... Solidifies when it comes in contact with air & answer ; School Talk ; Login Create.... ‘ Bombyx mori ’ ) are the major cash crops of India organelle does. Comes in contact with air of ( 1/4 ) or 0.25 mark for each correct answer scale the... To provide step-by-step Solutions in as fast as 30 minutes stored over a clean paper or piece of.. Exam AtoZ General Knowledge Questions and Answers about Agriculture 1 answer provided by your friends Others! Silk worms for commercial use is known as in the processing of wool answer Key AP.